TABLE 1

Primers used for screening of pKpQIL-like plasmids in this study

PCRPrimer no.aNameSequenceSize (bp)TargetReference
PCR-I1FIIK-repA-F1CTTCACGTCCCGTTTTGATT657IncFII repA gene34
2FIIK-repA-R1CGCTTCAGCGCTTCTTTATC34
PCR-II3QIL-F1ACAGGGAGTGCCAGGAAAG2,001Junction between Tn4401 tnpR and upstream IncFIIK2 backbone geneThis study
4QIL-R1TGTATTTGCATGGCGATGAGThis study
PCR-III5Tn4401v-F(3098U)TGACCCTGAGCGGCGAAAGC604bpKpQIL-associated Tn4401a isoform6
6Tn4401v-R1GCAAGCCGCTCCCTCTCCAG35
7Tn4401v-R(3781L)CACAGCGGCAGCAAGAAAGC6
PCR-IV8QIL-F2GCCTCAGATAGATGCGGTAGC1,831Junction between Tn4401 ISKpn6 and downstream geneThis study
9QIL-R2AAGCTGGAGACATGGAATGGThis study
PCR-V10QIL-hsdR-F1GGGTCGTTCACAAAGTCGAT498IncFIIK2-associated type I restriction modification system hsdR geneThis study
11QIL-hsdR-R1CGTTGAGCACTTCACCAAAAThis study
PCR-VI12K2-repB-F1CCATTCCGATCCTTTTCTGA395IncFIIK2 repFIB geneThis study
13K2-repB-R1AACGCTACTGTCCAGCCTGTThis study
  • a The locations of the primers are illustrated in Fig. 1.

  • b The sizes are variable for different Tn4401 isoforms. Isoform b, 703bp, 382bp; a, 604bp; c, 487bp; d, 635bp, 314bp; e, 448bp.