TABLE 2

Primers used for PCR mapping of the cassette network

Primer namePrimer sequence (5′ to 3′)
VIM-L1TCATTGTCCGTGATGGTGATGA
VIM-L2CCGGGCGGTCTAGACTTGCT
VIM-R1CGATATGCGACCAAACACCATC
VIM-R2GCCATTCAGCCAGATCG
attI1GGCATCCAAGCAGCAAGCGCGTT
sul1GTCCGACATCCACGACGTCTGATC