TABLE 1

Primers designed in this study

PrimerDNA sequence (5′ to 3′)TargetLength (bp)
Z5CGACTTATTTGATGGCTGACGTn20092,431
Z6CTTGTGGATGCAACTCGGTAT
Z7GTAAGGTTGAGCCTGAAGTTn20092,025
Z8TTTCTTTCCGATGCTTATTCC
Z9ATGCTCGCAATCGTTTATCGTTn20091,949
Z10TCGCCAACTTCTTTGACTTCTG
Rep-FACTCATCAAGGAATAAGACAGCrepAZJ221959
Rep-RATCACACTCGCACATACAAT