TABLE 1

PCR primers and conditions used for amplification and sequencing

PrimersSequence (5′ to 3′)Nucleotide positionPCR conditionsa
D (s)A (°C, s)E (s)
EmbC1FCGTCGTCGAGGACATTGGC4239803–42411693061, 4060
EmbC1RAGGGTCAAGGCACCGATGATG
EmbC2FCGGGCATGTTTCTGGCTGTCTG4241007–42422333061, 4060
EmbC2RGAATGCCGTTGGGTGTGAAGG
EmbC3FCCGGTCTAACCTACAGGCTTTGG4242073–42432403061, 4060
EmbC3RTGGGGCACGAGGCTCGATGGTA
EmbA1FAACCTAGGAACGGTGACT4243105–42437263058, 4040
EmbA1RCAACCTGTGGCTTCTTCT
EmbA2FCAACCAGGACACGGTCGTCG4243559–42451214062, 4090
EmbA2RTAGTTGCCGACGTAGAACCACC
EmbA3FCTTTGCCCGCATCGGTCTACAT4245005–42465344062, 4090
EmbA3RTCTGCTCGCGCACTGTGTCAT
EmbB1FATCAGGGCGCTGCCATGACA4246500–42478383062, 4060
EmbB1RAGTGTGAATGCGGCGGTAACGA
EmbB2FCTCGCTGGTCACCTATGTGCTG4247746–42489393062, 4060
EmbB2RGGCTGGTTGGGTTTCATCACG
EmbB3FTGGACGGCGATTCGGGTTCT4248813–42498263062, 4060
EmbB3RACTGCGGAGCCTGACGCTATG
  • a D, length of denaturation at 94°C; A, primer annealing conditions; E, length of extension at 72°C. All PCRs were 32 cycles, were preceded by a denaturation step at 94°C for 5 min, and included a final extension step at 72°C for 7 min.