TABLE 1

Oligonucleotides utilized in PCR amplification

NameSequencea
F-int-PSY-SmaCCCGGGTTTCAAATCAAATAAACTCACGTC
R-PSY-MluACGCGTTTTGACGTTTCTTGATAACACGTTTAAG
F-PSY-XhoCTCGAGATGGTTCACCTAAGTAAAAGAAATAATATT
F-PSYTGGTACGGGTTCACCAAAAAT
R-PSYCATTTTGAGTGCTTCTTCAACA
  • a Underlining denotes restriction sites.