TABLE 1

Oligonucleotides used for the study of gene expression in this study

SpeciesGenePrimer directionaPrimer sequence (5′ to 3′)Amplicon size (bp)Melting temp (°C)Annealing temp (°C)
E. coli and K. pneumoniaeacrBFTTTGCGTGGGTGATCGC1925450
RGTTATCGATACCGTTCATA52
E. coliacrFFTGGCCATTATYCTGATGA1795048
RGTTATCGATACCGTTCATA52
K. pneumoniaeFTTCATCGACCGGTCTTCG2085652
RAGATTGTCGATGCCGTTC54
E. coli and K. pneumoniaeacrDFGTGCTGGCAATCCTGTT1815250
RTATCGAGGCCGGTCATAT54
E. colimarAFTCATAGCATTTTGGACTGG1725452
RTTGCGCGATTTCCGTCAT54
K. pneumoniaeFAGCGCTCCGGTTACTCTAA1715856
RGCTGCGACTCGAAACCATA58
E. colisoxSFATTGACCAGCCGCTTAACAT1975854
RACATAACCCAGGTCCATTG56
K. pneumoniaeFTAGTCGCCAGAAAGTCAGG19058
RGAGAAGGTTTGCTGCGAGA56
K. pneumoniaeramAFCTGCAACGGCTGTTTTTACA1805856
RATTGAAGGTCCGGGTGAAG58
E. coligapAFGCTAACCTGAAATGGGACG1895856
RGTCCTGGCCAGCATATTTG58
K. pneumoniaegapAFGAAAGGCGTTCTGGGTTAC18458
RGATGTGGGCAATCAGATCC58
  • a F, forward; R, reverse.