TABLE 2

Primers

PrimerSequence (5′ to 3′)Descriptiona
JD321CCCGGGCGTTCGGAAGCCAAAAACTACfsrA deletion, upstream (XmaI)
JD324TGCACTGCAGCATTTGTTCACTCATCCCTTTCTfsrA deletion, upstream (PstI)
JD318GGATCCGTCAGCGCATAAATCAACCAAGfsrA deletion, downstream (BamHI)
JD323TGCACTGCAGGTCAAGGCGCTATTTCTTACTTAGfsrA deletion, downstream (PstI)
JD315CCCGGGGTTCTAGTGAAGGAGACTGTepaOX deletion, upstream (XmaI)
JD326TGCACTGCAGCACACTTTTCCCTCATTTTATTAATepaOX deletion, upstream (PstI)
JD312GGATCCCCACCTCTCAGTATAGCTACepaOX deletion, downstream (BamHI)
JD325TGCACTGCAGTAAGGAGTTAAAGATGTCAGAAATTepaOX deletion, downstream (PstI)
JD334GGATCCGAAACACATTCGTGGCTGATepaI deletion, upstream (BamHI)
JD348ATCCTGCAGGCCTTTATGAAGGAGGGAGAepaI deletion, upstream (PstI)
JD337CCCGGGCGTGCAGATAAAGAAGCTGTepaI deletion, downstream (XmaI)
JD349ATCCTGCAGTTCCTCATTGTAAGCAGGAATGepaI deletion, downstream (PstI)
JD354GGATCCCAGATTGGAGATATTCACTATGdnaK complementation (BamHI)
JD355CCCGGGTTATTTGTCATCACCATTTACTTCdnaK complementation (XmaI)
JD285GGATCCTCCTGTAAAAACAACGACTGfsrA complementation (BamHI)
JD286CCCGGGCGTTCGGAAGCCAAAAACfsrA complementation (XmaI)
JD287GGATCCATTCTGGGAATTACTCTTTTCCepaOX complementation (BamHI)
JD288CCCGGGGTGTTCCATAGTCAATGGAGAepaOX complementation (XmaI)
JD316CTCGAGTTAATCTCCCTCCTTCATAAAGGCepaI complementation (XhoI)
JD317GGATCCGTGTAAGTGAGGGGTTTTGTTAGepaI complementation (BamHI)
  • a Fragment amplified, with respect to the open reading frame start codon (upstream or downstream sequences).