TABLE 1

Bacterial strains, plasmids, and primers used in the study

Bacterial strain, plasmid or primerRelevant characteristicsaReference or source
Bacterial strains
    E. coil S17-1thi pro hsdR recA Tra+These laboratories
    P. aeruginosa
        PAO1Wild type
        PAO1 ΔrpoNPAO1 with an in-frame deletion of rpoNThis study
        PAO1 ΔrpoN ΔvqsRPAO1 with an in-frame deletion of rpoN and vqsRThis study
        PAO1 ΔrpoN ΔpqsAPAO1 with an in-frame deletion of rpoN and pqsAThis study
        PAO1 ΔrpoN ΔpqsEPAO1 with an in-frame deletion of rpoN and pqsEThis study
        PAO1 ΔrpoN ΔpqsHPAO1 with an in-frame deletion of rpoN and pqsHThis study
        PAO1 ΔrpoN ΔrhlRPAO1 with an in-frame deletion of rpoN and rhlRThis study
Plasmids
    pEX18GmBroad-host-range gene replacement vector; sacB Gmr41
    pJN105Arabinose-inducible gene expression vector; pBRR-1 MCS; araC-PBAD Gmr42
    pEX18Gm-ΔrpoNrpoN deletion suicide vectorThis study
    pEX18Gm-ΔvqsRvqsR deletion suicide vectorThis study
    pEX18Gm-ΔpqsApqsA deletion suicide vectorThis study
    pEX18Gm-ΔpqsEpqsE deletion suicide vectorThis study
    pEX18Gm-ΔpqsHpqsH deletion suicide vectorThis study
    pEX18Gm-ΔrhlRrhlR deletion suicide vectorThis study
Primers
    Primers for construction of mutant strains
        rpoN-upFATAGAATTCCGATCTCGGTCGGCGACATC
        rpoN-upRATAGGATCCCTGGAGGTCCAGGGTGGATAG
        rpoN-downFATAGGATCCGGCATAGCCCCTTCGAGCGAG
        rpoN-downRATAAAGCTTCTCCGGCAGCTCCCTGGCTA
        vqsR-upFATAGAGCTCGCCGGTGACCACCACGGTGG
        vqsR-upRATAGGATCCGACGCACGCTAGTGCGCCGC
        vqsR-downFATAGGATCCTGCGATATCCACACAACTACTCCTC
        vqsR-downRATAGCATGCGGCATAGCGATTGCCGGGAT
        pqsA-upFCTAATGGAGCTCAGGGAAGCCTGCAAATGGCAG
        pqsA-upRGTGATAAAGGGTGTCGCTGGCCTGGGAGAGAATGTA
        pqsA-downFGACACCCTTTATCACGACAACCTTCCGGAGG
        pqsA-downRCTAATGAAGCTTGCAATCCAGGTTGGGCCGGCA
        pqsE-upFATAGAATTCGCCGGCGAGAGTCTCGAA
        pqsE-upRATAGGATCCAAGCCTCAACATGGCCGGT
        pqsE-downFATAGGATCCCTGGACTGAGACGGGACAT
        pqsE-downRATAAAGCTTAGGCTGGACAGGCCATGC
        pqsH-upFCGACTCTAGAGGATCGTAAGGGGTTGACAGGAG
        pqsH-upRCACCGGCGGCTACTGGGTCATCCGTTGCTCCTT
        pqsH-downFCAGTAGCCGCCGGTGCCA
        pqsH-downRCCATGATTACGAATTGGACGACATCCGGCTTCA
        rhlR-upFCGACTCTAGAGGATCCGCCTACGCGCCACTGGG
        rhlR-upRGATGAGACCCAGCGCCCTCATTGCAGTAAGCCC
        rhlR-downFGCGCTGGGTCTCATCTGAAG
        rhlR-downRCCATGATTACGAATTTAGCGCGAAAGCTCCCAG
        pqsESD-FTTGGGCTAGCGAATTAGGAAACAGCTATGTTGAGGCTTTCGG
        pqsES-RTGGCGGCCGCTCTAGTCAGTCCAGAGGCAGCGCCTGGC
    Primers for qRT-PCR
        vqsR-FGCTGTCGATCGCCACTATCA
        vqsR-RTCGGAGTGGGACTTCACGTT
        pqsA-FCATCTCGCCGAACAGATTCC
        pqsA-RCCAACTTGCCGTTGTCGTT
        pqsR-FGCAGCTGATCGGCGACAT
        pqsR-FCAGCAGCACCCGGAGATT
        pqsH-FGCGCGGATCGAGTTCATC
        pqsH-RCAGGGCGATTCCCACTGA
        rhlR-FTTCGCCGTCCTGGAAAAG
        rhlR-RCGCCATAGGCGTAGTAATCGA
        rpoS-FCACTTCCTTCTCTCCAAACAACA
        rpoS-RAGCTGCGTTGCGTCCAA
        omlA-FCGAACTATCAACCAGCTGGTG
        omlA-RGCTGTGCTCTTGCAGGTTGTG
  • a Gmr, resistance to gentamicin; MCS, multiple-cloning site. In the oligonucleotide sequences, introduced restriction sites are underlined, and the sequences introduced for overlap extension PCR are in italics.