TABLE 1

Primers used for PCR cloning of blaCTX-M-14 and blaCTX-M-140 and for site-directed mutagenesis

Primer useDirection of primerPrimer sequence (5′–3′)Annealing temp (°C)
PCR cloning of blaCTX-M-14/blaCTX-M-140aForwardGCGTCTAGAATGGTGACAAAGAGAGTGCA50
ReverseGCGAAGCTTTTACAGCCCTTCGGCGATGA50
Introduction of A109E changeb,cForwardTTAACTACAATCCGATTGAGGAAAAACACGTCAACGGC64
ReverseGCCGTTGACGTGTTTTTCCTCAATCGGATTGTAGTTAA64
Introduction of A109D changeb,cForwardGTTAACTACAATCCGATTGACGAAAAACACGTCAACGGC66
ReverseGCCGTTGACGTGTTTTTCGTCAATCGGATTGTAGTTAAC66
Introduction of A109K changeb,cForwardGGTTAACTACAATCCGATTAAGGAAAAACACGTCAACGGCAC66
ReverseGTGCCGTTGACGTGTTTTTCCTTAATCGGATTGTAGTTAACC66
Introduction of A109R changeb,cForwardGTTAACTACAATCCGATTCGCGAAAAACACGTCAACGG66
ReverseCCGTTGACGTGTTTTTCGCGAATCGGATTGTAGTTAAC66
  • a XbaI and HindIII sites in the forward and reverse primers, respectively, are underlined.

  • b Modified base pairs are underlined.

  • c A, alanine; D, aspartic acid; E, glutamic acid; K, lysine; R, arginine.