TABLE 1

Primers used in this study for integron characterization

TargetPrimerNucleotide sequence (5′–3′)PositionaReference
intIINT1-mFGCCTGTTCGGTTCGTAAGCT908/927This study
INT1-FCCAAGCTCTCGGGTAACATC462/481
INT1-RCATGAAAACCGCCACTGC997/1014
qacEΔ1qacEΔ1-FGAAAGGCTGGCTTTTTCTTG3/22This study
qacEΔ1-RGCAGCGACTTCCACGATG311/328
ereAereA2-FTTGAGCGATTTTCGGATACC269/288This study
ereA2-RGGCATGAATCCTCCTTACCA1071/1090
qacqac-FCAATCTTTGGCGAGGTCATC29/488
qac-RCGCTGACCTTGGATAGCAG307/325
catB3catB3-FAAGGCAAGCTGCTTTCTGAG29/4821
catB3-RAACGATAGCGTAAGGCTCCA440/459
aadA1aadA1-FACATCATTCCGTGGCGTTAT284/303This study
aadA1-RAGGTTTCATTTAGCGCCTCA489/508
aacA4aacA4-FTGACCTTGCGATGCTCTATG12/31This study
aacA4-RCTGGCGTGTTTGAACCATGT470/489
aacA7aacA7-FCAGGCCTGTTGAAACTACCG21/4022
aacA7-RCTTGAGCAACCTCCGTGAAT414/433
blaOXAOXA-1FTATCTACAGCAGCGCCAGTG54/7321
OXA-1RTGCACCAGTTTTCCCATACA635/654
OXA-2FCGATAGTTGTGGCAGACGAA128/147
OXA-2RCTTGACCAAGCGCTGATGT564/582
tniCTniC-RTTTCCGAGCGAACAGTCGCT229/24822
blaIMPIMP-1FAAGGCGTTTATGTTCATACTTCG95/11719
IMP-1RTTTAACCGCCTGCTCTAATGTAA677/699
blaVIMVIM-2FATCATGGCTATTGCGAGTCC46/6519
VIM-2RACGACTGAGCGATTTGTGTG775/794
blaKPCKPC-FGTCACTGTATCGCCGTCTAGTTC3/2519
KPC-RTGGTGGGCCAATAGATGATT919/938
blaGESGES-FATGCGCTTCATTCACGCAC1/19This study
GES-RCTATTTGTCCGTGCTCAGGA864/845
blaNDMNDM-FGCCCAATATTATGCACCCGG9/2819
NDM-RCTCATCACGATCATGCTGGC649/668
oprDoprD-FGGAACCTCAACTATCGCCAAG−120/−99This study
oprD-RGTTGCCTGTCGGTCGATTAC17/1328
  • a Coordinates refer to the first base of each gene.