TABLE 1

Primers used for strain construction

Gene and primer nameSequencea
lptE
    P1ccaagcttgcatgcctgcagGCCAGCACCACAAGTTCAACAC
    P2TGCACCTGTACGCGCATCAGGACCAGGTCGTTGGC
    P3TGGTCCTGATGCGCGTACAGGTGCAGAAGGTCTAC
    P4cggtacccggggatccGGCGAATCCACTGCGGCAACTG
lpxC
    P5ccaagcttgcatgcctgcagCGCGGGTCCGGACCTGTCCCTG
    P6TTTTCCCCCGAATACAGACCGACGCCAGTAGCCCG
    P7GCGTCGGTCTGTATTCGGGGGAAAAGGTTTACCTG
    P8cggtacccggggatccAGGCATCGACCCAGTTGCTGC
lptD
    P9ccaagcttgcatgcctgcagGCCGGTTCGAACAGCTCGTCG
    P10TTGGTTGACGTACGTGACCTCGGCCAGCCAGCGCGA
    P11TGGCTGGCCGAGGTCACGTACGTCAACCAACGGGGC
    P12cggtacccggggatccTCTTGCCCATGTCCGAGGCAAG
    P13GCGATAGGTCAGAGTGATCCGCGTGTAGTCGACCTC
    P14GACTACACGCGGATCACTCTGACCTATCGCGGGGAC
    P15CTCGCGCCACAGAGAGAAGACCGGCAGGCTGTCTTG
    P16AGCCTGCCGGTCTTCTCTCTGTGGCGCGAGAACCGC
pagP
    P17ccaagcttgcatgcctgcagAAGGGAATCGAAGCGTCACGGTGAC
    P18CGAATTGCCGAGCAGCACCAGCCAGGCAGGTGCGGCGAGCAC
    P19GTGCTCGCCGCACCTGCCTGGCTGGTGCTGCTCGGCAATTCG
    P20cggtacccggggatccGACACCGAGAGGTTGGCGGTCTTGCTGAAG
  • a Underlining denotes a restriction site. The transition from lowercase to capital letters denotes the boundary between the vector and gene sequence.