TABLE 2

Primers used in this study

No.NameSequence (5′–3′)aDescription
1attB2_prsA_down-RGGGGACCACTTTGTACAAGAAGCTGGGTGCTACACAGGTGTAACAGCpKOR1-based allelic exchange
2attB1_prsA_up-FGGGGACAAGTTTGTACAAAAAAGCAGGCATATGCCCTGCCATATCCATpKOR1-based allelic exchange
3sacII_prsA_down-FATGCCCGCGGCACAAAACCGAGCGACCGTGGpKOR1-based allelic exchange
4sacII_prsA_up-RATGCCCGCGGAGTTGAAACTCCTTTGTAAGpKOR1-based allelic exchange
5upstream_primer_kpn_eco-FATGCGGTACCGAATTCTCCATATCATTTATAACAAAATAAFlanking primer for prsA site-directed mutagenesis
6prsA_PCR_bamHI-RCGCGGATCCGAATTAAAAGATATCGGACAGATGAGFlanking primer for prsA site-directed mutagenesis
7prsA-serine-FTTATTAGGCGCTTCTGGCGCTAGTGCCACAMutagenic primers for prsA site-directed mutagenesis (COL_prsA_serine)
8prsA_serine-RTGTGGCACTAGCGCCAGAAGCGCCTAATAAMutagenic primers for prsA site-directed mutagenesis (COL_prsA_serine)
9OL_pHu_pMK4_prsA_NC_down-FCTGATTCTGAAATTAAAGAACCAACAGACTTTAACAGTGAMutagenic primers for prsA site directed mutagenesis (COL_prsA_NterCter)
10OL_pHU_pMK4_prsA_NC_up-RTCACTGTTAAAGTCTGTTGGTTCTTTAATTTCAGAATCAGMutagenic primers for prsA site directed mutagenesis (COL_prsA_NterCter)
11New_N_signal_PPIase-FGCTTTATTATTAGGCGCTTGTGACAGCAAGAAAGCTTCACAMutagenic primers for prsA site-directed mutagenesis (COL_prsA_PPIase, COL_prsA_PPIase_Cter)
12New_N_signal_PPIase-RTGTGAAGCTTTCTTGCTGTCACAAGCGCCTAATAAAGCMutagenic primers for prsA site-directed mutagenesis (COL_prsA_PPIase, COL_prsA_PPIase_Cter)
13PrsA_PPIase_UAG_Bam-RGCATGGATCCCTATTTATCAGCTTTAATAATATGATMutagenic primers for prsA site-directed mutagenesis (COL_prsA_PPIase, COL_prsA_Nter_PPIase)
14N_UAG_Bam-RGCATGGATCCTTATTTAATTTCAGAATCAGMutagenic primers for prsA site-directed mutagenesis (COL_prsA_Nter)
15PrsA_C_N_signal-RTCACTGTTAAAGTCTGTTGGACAAGCGCCTAATAATAAAGCMutagenic primers for prsA site-directed mutagenesis (COL_prsA_Cter)
16PrsA_C_N_signal-FGCTTTATTATTAGGCGCTTGTCCAACAGACTTTAACAGTGAMutagenic primers for prsA site-directed mutagenesis (COL_prsA_Cter)
17PrsA-FAGTTAATGATAAGAAGATTGACGAACAAAprsA TaqMan
18PrsA-RGAAGGGCCTTTTCAAATTTATCTTTprsA TaqMan
19PrsA-P FAM/TAMRATGAAAAAATGCAAAAGCAATACGGCGGprsA TaqMan
20PPIase-FTAA-AGT-TAA-ATC-TAA-GAA-AAG-CGA-CAA-AGA-AprsA TaqMan
21PPIase-RCAA-ATT-TAC-TTG-GAT-CTT-TTG-AAA-CTT-CprsA TaqMan
22PPIase-P FAM/TAMRAAGA-CGA-TAA-AGA-AGC-GAA-ACA-AAA-AGC-TGA-AGA-AprsA TaqMan
23mecA_MGB_F1525TTCCACATTGTTTCGGTCTAAAATTmecA TaqMan
24mecA_MGB_R1603AATGCAGAAAGACCAAAGCATACAmecA TaqMan
25mecA_MGB_1553 VICCCA CGT TCT GAT TTT AAAmecA TaqMan
  • a Underlined regions represent restriction enzyme sites.