TABLE 1

Oligonucleotide primer sequences used in the PET-PCR PfPM2 copy number assaya

PET-PCR primerPET-PCR sequence (5′ to 3′)Tm (°C)Product size (bp)Melting temp range (°C)
PfPM2_FTGGTGATGCAGAAGTTGGAG59.87976.8–77.2
PfPM2_R_FAMaggcgcatagcgcctggTGGGACCCATAAATTAGCAGA59.4
Pf β-tubulin_FTGATGTGCGCAAGTGATCC61.98779.0–79.2
Pf β-tubulin_R_HEXaggcgcatagcgcctggTCCTTTGTGGACATTCTTCCTC60.5
  • a The PET-tag (lowercase letters in bold) attached to the 5′ end of the target-specific sequences does not show any homology to Plasmodium species. The PfPM2 (gene accession no. PF3D7_1408000-811659) and β-tubulin gene (gene accession no. PF3D7_1008700) primers were previously reported in the singleplex probe-based real-time PCR assay (16).