TABLE 5

DNA oligomer primers used in this study

GenePrimerSequence (5′-3′)
CaCDR1ForwardTGCCAAACAATCCAACAA
ReverseCGACGGATCACCTTTCATACGA
CaCDR2ForwardAAGGTTTTGATGCTACTGC
ReverseGTCGGACATGTGGCTCAAA
CaMDR1ForwardGTGTTGGCCCATTGGTTTTCAGTC
ReverseCCAAAGCAGTGGGGATTTGTAG
ERG11ForwardGGTGGTCAACATACTTCTGCTTC
ReverseGTCAAATCATTCAAATCACCACCT
ACT1ForwardAAGAATTGATTTGGCTGGTAGAGA
ReverseTGGCAGAAGATTGAGAAGAAGTTT