Table 2.

DNA sequences of the oligonucleotides used in this study

PrimerLocus (direction)aNucleotide sequence (5′ to 3′)
INT1 int(+)GCTGGATAGGTTAAGGGCGG
INT2 int (−)CTCTATGGGCACTGTCCACATTG
FLOR-F floR (+)TTATCTCCCTGTCGTTCCAGCG
FLOR-B floR (−)TCGTCGAACTCTGCCAAATG
SUL2-F sulII (+)AGGGGGCAGATGTGATCGAC
SUL2-B sulII (−)TGTGCGGATGAAGTCAGCTCC
STRA-F strA (+)TTGATGTGGTGTCCCGCAATGC
STRA-B strA (−)CCAATCGCAGATAGAAGGCAA
TMP-F dfr18 (+)TGGGTAAGACACTCGTCATGGG
TMP-B dfr18 (−)ACTGCCGTTTTCGATAATGTGG
TMP3 orfA (+)CATGCTGTTTCTCGACGGTG
TMP4 orf6 (−)GATCCGATCTGTTTGTTCAG
LEND4 orf1 (+)CCTTTGGTTACACATTCGC
LEFTF3 rum′B (−)GGTGCCATCTCCTCCAAAGTGC
RUMAIntergenicCGAGCAATCCCCACATCAAG
YL6 orf73 (+)TGTGGAACGGCTTTCTGACG
YL3 orfC5A (+)CGTTGGTTTGGGGTAACACC
  • a +, oligonucleotides corresponding to the coding strand (forward primer), −, oligonucleotides corresponding to the noncoding strand (backward primer).