TABLE 1.

Oligonucleotide primer sequences used for PCR amplification

GenePrimerPrimer sequence (5′→3′)Reference
GyrA GYRA/P1TGTCCGAGATGGCCTGAAGC 16
GYRA/P2TACCGTCATASGTTATCCACG
GyrB StygyrB1CAAACTGGCGGACTGTCAGG 20
StygyrB1TTCCGGCATCTGACGATAGA
parC StmparC1CTATGCGATGTCAGAGCTGG 13
StmparC2TAACAGCAGCTCGGCGTATT
parE StmparE1TCTCTTCCGATGAAGTGCTG 13
StmparE2ATACGGTATAGCGGCGGTAG
qnrS QnrS1ATGGAAACCTACAATCATACa
QnrS2AAAAACACCTCGACTTAAGT
QnrA QP1GATAAAGTTTTTCAGCAAGAGG 19
QP2ATCCAGATCGGCAAAGGTTA
  • a Sequences for the qnrS primers were designed based on the sequence of Shigella flexneri (17).