Table 3.

Primers for PCR–site-directed mutagenesis ofM. tuberculosis rpoB in plasmid pLN-2

PrimerPrimer sequenceaMutationb
rpoBSig-F5′ CAGCCAACTAAGCCAATTC 3′Signature nucleotides
rpoBSig-R5′ GTGCCGAAGAACTCCTTGAT 3′
rpoBVal516-F5′ TCATGGTCCAGAACAACCCG 3′Asp 516→Val (GAC→GTC)
rpoBVal516-R5′ ATTGGCTTAGTTGGCTG 3′
rpoBTyr526-F5′ GTTGACCTACAAGCGCCGA 3′His 526→Tyr (CAC→TAC)
rpoBTyr526-R5′ CCCGACAGCGGGTTGTTCTGGTC 3′
rpoBLeu531-F5′ GACTGTTGGCGCTGG 3′Ser 531→Leu (TCG→TTG)
rpoBLeu531-R5′ GGCGCTTGTGGGTCAA 3′
  • a All primers were phosphorylated on the 5′ end.

  • b Mutations in the rpoB of M. tuberculosis H37Rv contained on plasmid pLN-2 by use of PCR–site-directed mutagenesis.