Table 1.

Nucleotide sequences of the oligonucleotide primers used

Oligonucleotide primerPositionsaSequence (5′→3′)bDirection
MUT 12121–2142TCCTACCCGCGGCAAGACGGAForward
MUT 22121–2142TCCTACCCGCGGCAAGACGG C Forward
MUT 32121–2142TCCTACCCGCGGCAAGACGG G Forward
MUT 42121–2142TCCTACCCGCGGCAAGACGG T Forward
MUT 52122–2143CCTACCCGCGGCAAGACGGAAForward
MUT 62122–2143CCTACCCGCGGCAAGACGGA C Forward
MUT 72122–2143CCTACCCGCGGCAAGACGGA G Forward
MUT 82122–2143CCTACCCGCGGCAAGACGGA T Forward
MUT 92742–2762CACGTCCATCCCGGGCCTCTCReverse
R11962–1986GCGTTGAATTGAAGCCCGAGTAAACForward
R22789–2810TGTGTGCTACCCAGCGATGCTCReverse
  • a The numbering used is that of Taylor et al. (10), which differs from the numbering used in previous publications (2, 4, 9).

  • b Primers MUT 2 to MUT 4 and MUT 6 to MUT 8 differ from the WT 23S rRNA at the underlined positions.