Table 1.

Oligonucleotide primers used for PCR amplification

Primer pairLocation (5′-3′)aSequence (5′-3′)
V144–65TTGATGTTATGGAGCAGCAACG
V1′266–248CAATTGCCTTAACGTCTTG
V275–88AGCAGGGCAGTCGC
V2′254–236CGTCTTGTTCAACTTGCTG
V3235–254TCAGCAAGTTGAACAAGACG
V3′899–878CAACTGCTGTAATACTCCGAGC
V4684–708TGAGGGATACGACAACTCCTAAGGC
V4′1047–1027TGTTAGCCTTATCAGCGCGAC
  • a Oligonucleotide positions are given according to their location on the CARB-3 gene sequence as described elsewhere (4).