Table 1.

Oligonucleotides used in site-directed mutagenesis experiments and in DNA sequencing

Procedure and oligonucleotideSequence (5′-3′)aCodon change and nucleotide positionb
Mutagenesis
 Ile86→ValGGCGTCAACACGGGATAATATT→GTT
 Val184→AlaATTGCGGCAGGCATCGTGGGTA→GCC
 Met69→LeuTAAAAGTGCTCAGCATTGGAAAACATG→CTG
 Asn276→AspTCTGTCTATCTCGTTCATCCAAT→GAT
 Arg244→CysATGATACCGCAAGACCCCGC→TGC
 Glu104→LysGTGAGTATTTAACCAAGTCGAG→AAA
 Gly238→SerCACGCTCACTGGCTCCAGATTTATGGT→AGT
 Arg164→SerGTTCCCAAGAATCAAGGCCGT→TCT
Sequencing
 f-TEM2FGTATGAGTATTCAACATTTCCGTGTCG205-231
 f-TEM2RACCAATGCTTAATCAGTGAGGCA1064-1042
 f-TEMiACTGTCATGCCATCCGTAAGA556-536
 f-TEM2iCTGCGGCCAACTTACTTCTGACAA598-621
  • a Altered bases are underlined.

  • b Nucleotide positions are according to Sutcliffe (27).