Table 1.

Oligonucleotide primers

PrimerSequence (5′→3′)Application
23SP1ACGGCGGCCGTAACTATAPCR of a 307-bp fragment of 23S rRNA gene; sequencing of the PCR fragment from both directions
23SP2ACAGGCCAGTTAGCTA
gyrAP1ATGCATGAATTAGGCCTTACTPCR of a 360-bp fragment of gyrA gene; sequencing of the PCR fragment from both directions
gyrAP2TTCTTCACTCGCCTTAGTCAT
rpoBP1TTTGATTCGCTCATGCCCCATPCR of a 330-bp fragment of rpoB gene; sequencing of the PCR fragment from both directions
rpoBP2CACAACCTTTTTATAAGGGGC
rdxAP1TTTGAGCATGGGGCAGATTPCR of an 850-bp fragment covering the entire rdxA gene with primer rdxAP1 and rdxAP12; sequencing of the PCR fragment using all 5 primers
rdxAP2GAAGAAATCGCTGAAATCG
rdxAP3GTTAATGGTGGTATGCTCT
rdxAP4CAAATTTGCATGGGCGTGA
rdxAP12AGAGCGATTAAAACCATTCT