Table 1.

Primers used to detect genes spvC, sulI, sulII, and bla and deletion regions within thepef operon and between genes samA andtraT

PrimerDNA sequenceSize of DNA fragment (bp)Accession no. or source
Esam CCCGATAGCCCTGACGAAGAAT D90202
TraT4 TGTGCTCATCGAACCACACCCT 1,800This study
H4-pefF CGAACAGGGTGATGAATGAGAT L08613
RepB3 CGGCGTGAAAGAGCGCATGATGAT 859 U64797
SpvC1 CTTGCACAACCAAATGCGGAAGAT
SpvC2 CTCTGCATTTCACCACCATCACG 570 X56727
Sull-F TGGTGACGGTGTTCGGCAT
Sull-R GCTAGGCATGATCTAACCCT 841 X15014
SulI-F TCAACATAACCTCGGACAGT
SulII-R GATGAAGTCAGCTCCACCT 707 X57730
AP-F ATGAGTATTCAACATTTCCGTGT
AP-R TTACCAATGCTTAATCAGTGAGG 876 J01749