Table 1.

Nucleotide sequences of primers

PrimerNucleotide sequence (5′ → 3′)GenesAnnealing temp (°C)Reference
AmpC div sensAACGAGGTCGTCAGACG bla CdiA 4933
AmpC div A sensCAGAATATCTTTACGCCC
Class AAGCGAYAAYACGGCGATGClass Aa 558
Class A revTGCKCCGGTYTTATCGCC
SHV revGCGTTGCCAGTGCTCGATCAG bla SHV 626
SHV bisATGCGTTATATTCGCCTGTGTATT
TEM HTGAGATCGAAGGGCCGTT bla TEM 5254
TEM revGGTCTGACAGTTACCAAT
OXA CAGGTGCCATGAAAACATT bla OXA group 1b 45
OXA C bisTTAGCCACCAATGATGAA
OXA AAAGGAAAAGTTAATGGCA bla OXA group 2b 44
OXA A bisTTTATCGCGCAGCGTCCG
OXA EAGGACTTGGGACATCGAT bla OXA18 4748
OXA E bisTGACTGGTCAGAAGTTTT
OXA BAAGGAGGCTTCCTTGATAA bla OXA20 4938
OXA B bisTTGGGTGGCAAAGCATTG
OXA CAs indicated above bla OXA13 4937
OXA O bisTTATGTGCTTAGTGCATC
SmeACGGTCCTGA GGGGATGAC bla Sme-1 5339
SmeBCGTGATGCTTCCGCAATA
A1GGAATTCCTWTGCTGCGCBCTGCTGCT bla AmpC c 6034
A2CGGGATCCCTGCCAGTTTTGATAAAA
B1GGAATTCCTCAFCGAGCAGACSCTGTT bla AmpC c 6034
B2CGGGATCCCCCGCACMTKAYRTAGOTGTGG
CsA SGCGCTGATTAATACCGC bla Sed-1 49Present study
CsA ASGCATCCTGCTGTGGCTGT
CUM 1GGTCGTTTAGGTTAAAAC bla CUM 4822
CUM 1 bisCCAGTGTTTTGGTAAACC
OXY 1GTTCGTGGCGTAAAAC bla OXY 4925
OXY 1 revTAACACCTCTTTGCGGCT
RNA-SAGAGTTTGATCCTGGYTCAG16S RNA5661
RNA-ASCTTTACGCCCARTAAWTCCG
  • a Degenerated oligonucleotide primer designed from the consensus sequence of five class A β-lactamase genes (bla CdiA, bla OXY,bla TOHO-1, bla MEN, andbla SHV).

  • b Group 1 included oxacillinases OXA-5, -7, -11, -14, -16, and -17 and OXA-10 or PSE-2 (16, 18, 19, 21, 28,29, 52). Group 2 included oxacillinases OXA-2, -3, -15, and -21 (17, 20, 50, 57).

  • c Degenerated oligonucleotide primers were designed from the consensus sequence of the ampC genes ofE. coli, E. cloacae, and C. freundii for A1 and A2 and from MOX-1, FOX-1, and ampC of S. marcescens for B1 and B2.